국립생태원에서 제공하는 수많은 자료를 e-Book으로 볼 수 있습니다.

HOME검색결과

통합검색

''에 대한 총 60,112건의 검색결과가 있습니다.
  • 제목 : 우리지역 생태자산과 생태계서비스(창녕)

    발행일 : | 조회수 : 4387

    카테고리 :

    17 _2018

  • 제목 : (2016) 국가장기생태연구

    발행일 : 2014-01-01 | 조회수 : 20162

    카테고리 :

    ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????

  • 제목 : 사회성 동물의 행동생태 연구. Ⅱ

    발행일 : 2015-01-01 | 조회수 : 6569

    카테고리 :

    Korean ants will be conducted, and continuous research can demonstrate the role of the symbiont in the family Formicidae. Ants are an ideal insect outbreak model system since they show vigorous reproductivity. Consequently, to study the reproduction structure of ants is important to understand insect outbreak mechanism and facilitates appropriate policy proposal. 2. Development of social behavior ...

  • 제목 : 합성 Cry 살충 단백질을 이용한 토양미생물 군집변화. Ⅰ

    발행일 : 2014-01-01 | 조회수 : 2798

    카테고리 :

    8 . 1. B. thuringiensis Cry1Ac B. thuringiensis Cry1Ac 1 Cry1Ac Full F NdeI , Cry1Ac Full R NotI DNA PCR . 1 3.5 kb DNA . 1. 5 3 Cry1Ac Full F NdeI ccccatatgatggataacaatccgaacatcaatgaatgca Cry1Ac Full R NotI cccgcggccgcctattcctccataaggagtaattcc...

  • 제목 : 우리지역 생태자산과 생태계서비스(파주)

    발행일 : | 조회수 : 5595

    카테고리 :

    17 _2019

(우)33657 충청남도 서천군 마서면 금강로 1210 본관 112호 도서관 Tel) 041-950-5800 Fax) 041-950-6117
COPYRIGHT(C) 2014 National Institute of Ecoloy Library. ALL RIGHTS RESERVED.

저작권 정책