국립생태원에서 제공하는 수많은 자료를 e-Book으로 볼 수 있습니다.
통합검색
-
-
제목 : (2016) 국가장기생태연구
발행일 : 2014-01-01 | 조회수 : 20162
카테고리 :
???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????
-
제목 : 사회성 동물의 행동생태 연구. Ⅱ
발행일 : 2015-01-01 | 조회수 : 6569
카테고리 :
Korean ants will be conducted, and continuous research can demonstrate the role of the symbiont in the family Formicidae. Ants are an ideal insect outbreak model system since they show vigorous reproductivity. Consequently, to study the reproduction structure of ants is important to understand insect outbreak mechanism and facilitates appropriate policy proposal. 2. Development of social behavior ...
-
제목 : 합성 Cry 살충 단백질을 이용한 토양미생물 군집변화. Ⅰ
발행일 : 2014-01-01 | 조회수 : 2798
카테고리 :
8 Ⅲ. 연구결과 및 고찰 1. B. thuringiensis로부터 Cry1Ac 유전자 분리 배양된 B. thuringiensis 균으로부터 Cry1Ac 유전자를 분리하기 위해 표 1에서 열거한 프라이머중 Cry1Ac Full F NdeI , Cry1Ac Full R NotI 두 개의 프라이머를 이용하여 DNA PCR 반응 실험을 수행 하였다. 그 결과 그림 1에서 보이는 것과 같이 약 3.5 kb 의 증폭된 DNA 절편을 얻을 수 있었다. 표 1. 사용된 프라이머 리스트 프라이머 염기서열 5′ → 3′ Cry1Ac Full F NdeI ccccatatgatggataacaatccgaacatcaatgaatgca Cry1Ac Full R NotI cccgcggccgcctattcctccataaggagtaattcc...
-
