국립생태원에서 제공하는 수많은 자료를 e-Book으로 볼 수 있습니다.

HOME검색결과

통합검색

''에 대한 총 60,112건의 검색결과가 있습니다.
  • 제목 : (2017) 기후변화에 의한 생물 적응 현상 연구. Ⅲ

    발행일 : 2017-01-01 | 조회수 : 5412

    카테고리 :

    62 31.

  • 제목 : 전국자연환경조사 데이터북. 2권,한국의 동물 1

    발행일 : 2014-01-01 | 조회수 : 10005

    카테고리 :

    77 Cobitis hangkugensis Cobitis lutheri Cobitis tetralineata Iksookimia choii Iksookimia hugowolfeldi Iksookimia koreensis Iksookimia longicorpa Iksookimia pacifca Iksookimia pumila Iksookimia yongdokensis Kichulchoia brevifasciata Kichulchoia multifasciata ...

  • 제목 : 자연생태계 내 유전자변형생물체 검출법

    발행일 : 2017-01-01 | 조회수 : 6932

    카테고리 :

    79 PART 04?LMO ?DP-305423-1 [ ] 5`-3` DP-305423-1 DP-305423-1L-JP1 CGTGTTCTCTTTTTGGCTAGC DP-305423-1L-JV1 GTGACCAATGAATACATAACACAAACT DP-305423-1L-P1 AGATGCAAGGGATTAAAAGTATTTTT DP-305423-1L-P2 GACATTTTTGACCATTCAAGTAAAAT M100bp DNA marker; 1, 6 primer 211bp ; 2, 7DP-305423-1L-JV1 + DP-305423- 1L-JP1 93bp ; 3, 8DP-305423-1L-JV1 + DP-305423...

  • 제목 : 생태계교란생물 모니터링. 4

    발행일 : 2017-01-01 | 조회수 : 7239

    카테고리 :

    55 7 14 610 , , , , , , , , , , , , , 20 251, 41.1% 30.5% . 3.1% . 2014 2015 , 2016 1, 2017 35 5.7% . 8 15 459 , , , , ...

  • 제목 : 국립생태원 국제협력 공동연구

    발행일 : 2017-01-01 | 조회수 : 27102

    카테고리 :

    63 Overall, less than 2/5th of the CPs assessed Ramsar sites for ecological services, with the lowest number of reports in Africa. From the ecosystem services assessed, services with an obvious, direct impact upon human livelihoods food, fresh water, recreation, and tourism had the highest report rates, while indirect regulation services, such as pollination, nutrient cycling, and pest control wer...

(우)33657 충청남도 서천군 마서면 금강로 1210 본관 112호 도서관 Tel) 041-950-5800 Fax) 041-950-6117
COPYRIGHT(C) 2014 National Institute of Ecoloy Library. ALL RIGHTS RESERVED.

저작권 정책