국립생태원에서 제공하는 수많은 자료를 e-Book으로 볼 수 있습니다.

HOME검색결과

통합검색

''에 대한 총 60,112건의 검색결과가 있습니다.
  • 제목 : (2017) 기후변화 민감생태계 관리 및 보전방안 연구 : 아고산생태계 구상나무의 위협요인과 보전

    발행일 : 2017-01-01 | 조회수 : 10227

    카테고리 :

    35. DCA 36. CCA Sasa릿, Aspect, EC, Ele, TP, Slope, Ca , OM 55

  • 제목 : (2017) 자연생태계 내 유전자변형생물체 선별기술 개발

    발행일 : 2017-01-01 | 조회수 : 4215

    카테고리 :

    55 . 1 LM 2 5307 MON87427 duplex PCR . Non-LM LM 26, 39 26. No 53 bp 1 S-5307-F1 F ATTATCGCGCGGTGTCAT 183 Maize 5307-R R TGGTTCATTGTATTCTGGCTTTG 5307 2 S-MON87427-F5 F CAGCCGGTGGTTATAATGACAAAT ...

  • 제목 : (2017) LMO 자연환경 모니터링 및 사후관리 연구. [9]

    발행일 : 2017-01-01 | 조회수 : 9300

    카테고리 :

    59 2. PCR -CruA -Multiplex 3.

  • 제목 : 국립생태원 국제협력 공동연구

    발행일 : 2017-01-01 | 조회수 : 27195

    카테고리 :

    57 Figure 2. Amount of wetland area preserved by the Ramsar convention and the number of sites designated per year and in total Ramsar 2017b The contracting parties CPs acknowledged the interdependence of man and his environment, recognizing that wetlands play a key roles in the global hydrological cycle and have multiple material and non/material values Finlayson et al. 2011 The remaining artic...

  • 제목 : (2016) DMZ 일원 생태계 조사 : 민통선이북지역 동북산악권역

    발행일 : 2014-01-01 | 조회수 : 14435

    카테고리 :

    . www.nie.re.kr ? 63 a b c d 61.

(우)33657 충청남도 서천군 마서면 금강로 1210 본관 112호 도서관 Tel) 041-950-5800 Fax) 041-950-6117
COPYRIGHT(C) 2014 National Institute of Ecoloy Library. ALL RIGHTS RESERVED.

저작권 정책