국립생태원에서 제공하는 수많은 자료를 e-Book으로 볼 수 있습니다.

HOME검색결과

통합검색

''에 대한 총 60,112건의 검색결과가 있습니다.
  • 제목 : 생태계 훼손지 및 복원지의 진단 평가와 회복력 증진 방안

    발행일 : 2017-01-01 | 조회수 : 15971

    카테고리 :

    ? 1 11 12 ? 8 12 20 4 4 , , ? 6 6 , , ? , ? 1 1 , , , 2 2 , ? , ? , , ? ? 4 4 ? ? ? 2 2 ? 1 1 ? 1 1 , 21.

  • 제목 : 자연생태계 내 유전자변형생물체 검출법

    발행일 : 2017-01-01 | 조회수 : 7633

    카테고리 :

    49 PART 04?LMO ?DAS-40278-9 [ ] 5`-3` DAS-40278-9 DAS-40278-9L-JV1 TGGTTCATTGTATTCTGGCTTTG DAS-40278-9L-JP1 CACGAACCATTGAGTTACAATC DAS-40278-9L-P1 TCTCTAAGCGGCCCAAACTTG DAS-40278-9L-P2 CAGGAGACCTCGCTTGTAACC DAS-40278-9L-P3 TAGGAGACATATGATCCTCATG M100bp DNA marker; 1, 6 primer 179bp ; 2, 7DAS-40278-9L-JV1 + DAS- 40278-9L-JP1 98bp ; 3,...

  • 제목 : (2018) 제2차 국가장기생태연구

    발행일 : 2018-01-01 | 조회수 : 16939

    카테고리 :

    xlii In order to carry out a study on biodiversity change in climate region of East Asia, the Bogor Agricultural University of Indonesia conducted a study on the change of biodiversity according to the environmental change of a tropical mountain region. In addition, we established MOU with the FSC Field Science Center for Northern Biosphere in Hokkaido, Japan, and laid the foundation for future co...

  • 제목 : (2015) 국가장기생태연구 : 제2차, 1단계 2차년도 보고서

    발행일 : 2015-01-01 | 조회수 : 17143

    카테고리 :

    30 m Mt. Jeombong 7 128° 25 -128°30 38°0 38°5 980±50 m . 1135.7 mm 10.2 , 1 ?4.8 , 8 16.6 . , , CO2 flux ...

  • 제목 : 외래생물 전국 서식 실태조사. 2

    발행일 : 2014-01-01 | 조회수 : 18795

    카테고리 :

    29 1-1 1-2 1-3 2-1 2-2 2-3 3-1 3-2 7.

(우)33657 충청남도 서천군 마서면 금강로 1210 본관 112호 도서관 Tel) 041-950-5800 Fax) 041-950-6117
COPYRIGHT(C) 2014 National Institute of Ecoloy Library. ALL RIGHTS RESERVED.

저작권 정책