국립생태원에서 제공하는 수많은 자료를 e-Book으로 볼 수 있습니다.

HOME검색결과

통합검색

''에 대한 총 60,112건의 검색결과가 있습니다.
  • 제목 : (2015) 국가 생태계 기후변화 리스크 평가

    발행일 : 2015-01-01 | 조회수 : 11615

    카테고리 :

    ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?

  • 제목 : PNIE(Proceedings of National Institute of Ecology) Vol. 2 Issue 1

    발행일 : | 조회수 : 1901

    카테고리 :

    Baek-Jun Kim 34 PNIE 2021;2 1 32-41 ing, overexploitation, habitat destruction, and habitat fragmentation in South Korea Ministry of Environment, 2002; Yang, 2002 In particular, habitat fragmentation is a major issue in the conservation of the goral. For wild populations, habitat fragmentation has caused decreased connectivity, i.e., the degree to which the landscape facilitates or impedes movemen...

  • 제목 : 국가 생태계서비스 평가 : 국가생태계서비스 중장기 전략 기본 구상

    발행일 : 2014-01-01 | 조회수 : 4529

    카테고리 :

    22 3 3 · Drivers , pressure , state , Impact , response . , , . . 2012 OCI, Ocean Health Index , , , , ...

  • 제목 : 기후변화 대응 취약생태계 적응 현상분석 및 보전방안 연구

    발행일 : 2014-01-01 | 조회수 : 13485

    카테고리 :

    20 Condition Gene Primer name Sequence GC % Circadian CCA1 CCA1 RT -F AACACCTGAGAGTGATGCAAAG 45.45 CCA1 RT -R GGATCGGTTATATTGGAGCTGA 45.45 15. CCA1 CO2 . Actin2 Actin2 Hemmes et al., 2012 Actin2 , . Actin2 , 16

  • 제목 : 국가 생태계서비스 평가 : 국가 생태계서비스 평가 보고서 발간을 위한 기초 연구

    발행일 : 2014-01-01 | 조회수 : 7784

    카테고리 :

    18 4. , transdisciplinary community building cooperative knowledge generation . 9 - 4 , 4 , 2 , 2 4 ...

(우)33657 충청남도 서천군 마서면 금강로 1210 본관 112호 도서관 Tel) 041-950-5800 Fax) 041-950-6117
COPYRIGHT(C) 2014 National Institute of Ecoloy Library. ALL RIGHTS RESERVED.

저작권 정책