국립생태원에서 제공하는 수많은 자료를 e-Book으로 볼 수 있습니다.
통합검색
-
제목 : (2016) 전국 뉴트리아 서식실태조사
발행일 : 2014-01-01 | 조회수 : 11148
카테고리 :
하 낙동강 외 서식현황 ···································································107 다. 서식개체수 추정 ···············································································111 1 국내 서식 개체수 ···········································································111 라. 저밀도 서식지역에서의 개체 검출 ···············································113 1 부유형 설치물의 적용 ············································...
-
-
-
제목 : 자연생태계 내 유전자변형생물체 검출법
발행일 : 2017-01-01 | 조회수 : 7659
카테고리 :
자연생태계 내 유전자변형생물체 검출법 25 PART 04?LMO별 분석법 옥수수?NK603 [ 검출 프라이머 정보 ] 이벤트명 프라이머명 염기서열 5`-3` NK603 NK603L-JV1 ATGAATGACCTCGAGTAAGCTTGTTAA NK603L-JP1 AAGAGATAACAGGATCCACTCAAACACT NK603L-P1 GATGTCGACCTCCTAAAAAAAGACGTCTG NK603L-P2 CTGGTAGCGGAAGAGATGCCGC NK603L-P3 GTCAGCAGAACAGCAGTAGATGC M100bp DNA marker; 1, 6옥수수 내재유전자 primer 179bp ; 2, 7NK603L-JV1 + NK603LJP1 108bp ; 3, 8NK603L-JV1 + NK603L-P1 212bp ; 4,...
-
제목 : Ecosystem services for implementing environmental policies : a quick guide for policy makers
발행일 : 2019-01-01 | 조회수 : 3335
카테고리 :
84 조류 63종 긴꼬리딱새 Ⅱ급 긴점박이올빼미 Ⅱ급 까막딱다구리 Ⅱ급 생물정보 바로가기 생물정보 바로가기 생물정보바로가기2, the Club of Rome predicted that the Earth would no longer be able to sustain a growing population in the early 21st century. Standards mentioned as being used to predict the Planetary Boundary included climate change, destruction of the ozone layer, ocean acidifcation, reduction of biodiversity, use of freshwater, change in lan...
